Материалы конгрессов и конференций

VII РОССИЙСКАЯ ОНКОЛОГИЧЕСКАЯ КОНФЕРЕНЦИЯ

СОМАТИЧЕСКИЕ МУТАЦИИ ГЕНА К-RAS В АДЕНОКАРЦИНОМАХ ТОЛСТОЙ КИШКИ И ПОДЖЕЛУДОЧНОЙ ЖЕЛЕЗЫ И ИХ ДИАГНОСТИЧЕСКОЕ И ПРОГНОСТИЧЕСКОЕ ЗНАЧЕНИЕ

Т.П. Казубская1, М.А. Сазонова2, В.Н. Калинин2, Е.Л. Корчагина1, Р.Ф. Гарькавцева1, Ф.А. Амосенко1

1ФГБУ «НМИЦ онкологии им. Н.Н. Блохина» Минздрава России, Москва
2МГ МЦ РАМН*, Москва

Развитие аденокарцином поджелудочной железы и толстой кишки протекает с минимальными клиническими симптомами, поэтому только в небольшом числе случаев эти опухоли диагностируются на ранних стадиях. В этой связи поиск новых методов ранней диагностики сосредоточен на молекулярной этиологии этих заболеваний. К настоящему времени уточнена диагностическая значимость определения мутаций в генах семейства ras (Н-ras, К-ras, N-ras) [7]. Возможность использования соматических мутаций в К-ras онкогене в диагностических целях обусловлена их высокой частотой в опухолях разных локализаций, небольшими размерами гена, при которых, как правило, мутация локализована в специфическом кодоне. При этом K-ras мутации регистрируются при раке поджелудочной железы, толстой кишки, в полипах, мелких аденомах толстой кишки, что позволяет рассматривать их в качестве перспективных маркеров для ранней диагностики этих неоплазий.

В настоящей работе проведен молекулярный анализ мутаций в гене K-ras (кодон12 и 13) в образцах опухолевых тканей больных со спорадическими аденокарциномами с целью оценить их диагностическую и прогностическую значимость при раках толстой кишки и поджелудочной железы.

Материалом для исследования послужили образцы опухолевых тканей, полученные от 64 российских пациентов: 50 образцов аденокарцином и 1 беркиттоподобной лимфомы, 8 аденокарцином поджелудочной железы и 1 карциноид и 4 образца рака легкого (2 аденокарциномы, 2 плоскоклеточных рака). У каждого из этих больных было проведено хирургическое удаление опухоли, паллиативное или в полном объеме. Клинические данные пациентов приведены в табл. 1.

Таблица 1.
Клинические данные больных с опухолями толстой кишки, поджелудочной железы, легкого.

Диагноз Пол (м/ж) Возраст Стадия заболевания Всего
I II III IV
Рак толстой кишки 23/28 60,7±9,2 1 11 22 17 51
Рак поджелудочной железы 4/5 64±7,8 - 3 4 2 9
Рак легкого 4/0 55+6,5 - 2 2 - 4

Отбор образцов опухолей из операционного материала проводили методом микродиссекции под гистологическим контролем, поэтому полученные препараты содержали не менее 70% опухолевых клеток. В качестве контроля использовали 55 образцов с гистологически верифицированными нормальными тканями от больных раком толстой кишки и легкого, а также 9 образцов из лимфоцитов периферической крови больных раком поджелудочной железы. Геномную ДНК из опухолевых и нормальных тканей, а также из лимфоцитов периферической крови выделяли с помощью набора QIAamp Blood and Tissue Kit фирмы QIAGEN в соответствии с протоколом. При амплификации K-ras–фрагментов (157 п.о. и 200 п.о.), содержащих 12 и 13 кодоны, использовали следующие праймеры: 1. 5/ ACTGAATATAAACTTGTGGTAGTTGGACCT 3/ и 5/ TCAAAGAATGGTCCTGGACC 3/ - для фрагмента размером 157 п.о., 2. 5/ GTACTGGTGGAGTATTTGATA 3/ и 5/ ACTCA TGAAAATGGTCAGAGA 3/ - для фрагмента размером 200 п.о. Реакционная смесь объемом 35 мкл содержала 0,3-0,4 мкг геномной ДНК, 25 пикамоль каждого праймера, 200 мкМ каждого дезоксирибонуклеозидтрифосфата, 10 мМ трис/HCl (pH 8,3), 50 мМ KCl, 2 мМ MgCL2 и 1,5 ед. Taq-полимеразы (“Perkin Elmer”). Режим ПЦР: денатурация ДНК при 95OC в течение 3 минут, затем: 94OC – 1 мин., 55OC –1 мин., 72OC –30 сек., всего – 30 циклов, с заключительным синтезом при 72OC в течение 7 мин. Рестрикционный анализ продуктов ПЦР (фрагмент 157 п.о.) проводили с помощью эндонуклеазы Bst NI в условиях, рекомендованных изготовителем (“New England BioLabs”). Продукты рестрикции выявляли методом электрофореза в ПАА гелях после окрашивания их бромистым этидием. SSCP-анализ амплифицированного экзона 1 гена K-ras (157 п.о. и 200 п.о.) - безизотопным методом [1]. Секвенс амплифицированных генов K-ras (200 п.о.), содержащих аномалии, проводили с помощью автоматического секвенатора фирмы “Applied BioSystems”, модель 377, используя систему «BigDye-terminators». Статистический анализ полученных данных проводился общепринятыми методами статистики.

В табл. 2 приведены мутации в гене K-ras, выявленные у больных раком толстой кишки и поджелудочной железы. Все 6 мутаций различны, затрагивают 12 и 13 кодоны гена K-ras и относятся к однонуклеотидным заменам. Наиболее частой из них у пациентов с аденокарциномой толстой кишки является известная замена GT→CT в к.12 (21,6%). Эта мутация приводит к исчезновению сайта рестрикции для эндонуклеазы Bst NI в одном из аллелей гена, что было использовано для ее детекции: при рестрикции ПЦР-продукта размером 157 п.о. в случае отсутствия мутации имеется два сайта для эндонуклеазы, что приводит к образованию трех фрагментов (114 п.о., 29 п.о. и 14 п.о.).

Таблица 2.
К-ras мутации в 12 и13 кодонах у больных раком толстой кишки и поджелудочной железы.

Мутации Толстая кишка Поджелудочная железа
к.12 GGT
→GCT
21,6% (11/51) 33,3% (3/9)
→AGT 2,0% (1/51) 0%
→GAT 7,8% (4/51) 0%
→GTT 0% 11,1% (1/9)
К.13 GGC
→GAC
3,9% (2/51) 0%
→CGC 2,0% (1/51) 0%
Всего 37,3% (19/51) 44,4% (4/9)

Примечание: достоверность различия частоты мутаций: 1) GGT→GCT в к.12 в нормальных образцах и в опухолевых тканях толстой кишки и поджелудочной железы p<0,005 и p<0,05 соответственно; 2) GGT→GAT в к.12 нормальных образцов и опухолях толстой кишки p<0,005; 3) в первом экзоне гена K-ras нормальных образцов и в опухолевой ткани толстой кишки и поджелудочной железы p<0,001 и p<0,05 соответственно; 4) достоверных отличий между общими частотами мутаций в первом экзоне гена K-ras образцов опухолей поджелудочной железы и толстой кишки нет.

При наличии мутации, вследствие исчезновения одного из сайтов рестрикции образуются фрагменты 143 п.о. и 14 п.о. Для 7 опухолевых образцов результаты рестрикционного анализа были подтверждены секвенированием. У пациентов с аденокарциномой поджелудочной железы частота точечной мутации GGT→GCT в к.12 составляет 33,3% (табл. 2). Еще 5 типов известных K-ras мутаций в опухолевых образцах были выявлены в ходе SSCP-анализа и детектированы с помощью автоматического секвенирования. При этом были секвенировано 9 образцов с мутациями, отличными от замены GT→CT в к.12, и 4 контрольных образца (без аномалий в гене K-ras). Результаты SSCP-анализа приведены на рис. 1. В итоге мутации в гене K-ras обнаружены у больных с аденокарциномами толстой кишки в 31,4% в к.12 и 5,9% в к.13. В группе аденокарцином и плоскоклеточного рака легкого мутации в гене K-ras не обнаружены, возможно, из-за незначительного количества обследованных больных. Мутации не были выявлены и в беркиттоподобной лимфоме толстой кишки и карциноиде поджелудочной железы. Ни в одном из исследованных образцов с нормальными тканями толстой кишки и поджелудочной железы, а также в лимфоцитах периферической крови мутации в гене K-ras обнаружены не были.

Рак поджелудочной железы, как и рак толстой кишки, относятся к опухолям поздней манифестации. В изученной нами выборке больных возраст варьировал от 29 до 85 лет и в среднем составил 60,7±9,2 года для больных с опухолями толстой кишки и 64±7,8 года - для больных с опухолями поджелудочной железы, что совпадает со средним возрастом пациентов с этими заболеваниями из Америки (62,5–65,4 года) [13]. Количество женщин в исследованной группе больных было ненамного больше, чем мужчин: 28 из 51 (51,5%) с опухолями толстой кишки и 5 из 9 (55,6%) с опухолями поджелудочной железы (табл. 1). Частота мутаций в гене К-ras у российских женщин оказалась в 2,6 раза больше, чем у мужчин (28,1% и 10,9% соответственно). Определение частоты мутаций K-ras в зависимости от стадии заболевания не проводилось, поскольку большинство опухолей рассматриваемых локализаций были получены от пациентов с III и IV стадиями заболевания (39/51 и 6/9 соответственно). В табл. 3 представлены клинико-морфологические данные 4 пациентов с опухолями поджелудочной железы, в которых было обнаружено присутствие мутаций в гене K-ras.

Таблица 3.
Клинико-морфологические данные больных раком поджелудочной железы, с мутациями в к.12 гена K-ras.

Пол/ возраст Стадия Гистологическая структура рака поджелудочной железы Семейные накопления опухолей Мутации
Женский, 58 лет IV Аденокарцинома умеренной степени дифференцировки Мать-дочь (рак головки поджелудочной железы) GGT→GCT
Женский, 60 лет II Аденокарцинома разной степени дифференцировки с преобладанием низкодиф-
ференцированной
Мать-дочь (рак головки поджелудочной железы) GGT→GCT
Женский, 69 лет IIIб Аденокарцинома разной степени дифференцировки Без накоплений GGT→GTT
Мужской, 72 года IIIа Аденокарцинома умеренной степени дифференцировки Отец-мать (рак желудка), сын - рак поджелудочной железы GGT→GCT

Как видно из таблицы, анализируемая группа больных находилась на разных, в основном поздних стадиях заболевания. Возраст пациентов, у которых были выявлены мутации, в среднем составил 64 года. Надо сказать, что из 9 больных раком поджелудочной железы только у 4 имелись указания на поражение злокачественными опухолями родственников 1-ой степени родства, и 2 случая из них были семейными раками той же локализации. По данным литературы, семейный рак поджелудочной железы составляет небольшую часть от всех неоплазий этой локализации, и в основе их развития могут быть наследственные факторы [10]. Наиболее существенными факторами, которые могли бы способствовать формированию групп риска, являются семейный хронический панкреатит и длительно существующий сахарный диабет. Однако у наших пациентов с выявленными мутациями только в одном случае больная длительное время страдала сахарным диабетом.

Таким образом, сопоставление клинико-генеалогических и выявленных молекулярных изменений при раке поджелудочной железы позволило нам отметить независимость мутаций в онкогене К-ras от степени дифференцировки опухоли, ее прогрессии и наследственной предрасположенности в случае семейного рака этой локализации. Полученные результаты позволяют обсуждать возможность существования одного из патологических путей в развитии рака поджелудочной железы, при котором мутации в гене K-ras могут занимать существенное место.

Рак толстой кишки представлен в изучаемой выборке 51 больным: 50 больных с аденокарциномой и 1 больной с лимфомой Беркитта. Возраст манифестации рака толстой кишки в среднем составил 61,6 года, что несколько меньше, чем возраст больных раком поджелудочной железы. Кроме того, возраст развития опухоли у женщин был несколько больше, чем у мужчин (62,9 и 59,9 года соответственно). В табл. 4 приведена частота K-ras мутаций в различных возрастных группах больных раком толстой кишки. Отметим, что частота замен в гене K-ras в подгруппе 50-55 лет в 2,8 раза превышает частоту в подгруппе 56-70 лет (p<0,05).

Таблица 4.
Частота точечных мутаций в гене K-ras в различных возрастных группах больных с аденокарциномами толстой кишки.

Возраст пациентов Частота мутаций
29–49 50,0% (3/6)
50–55 60,0% (6/10)
56–70 21,7% (5/23)
71–85 45,5% (5/11)

Изучение генеалогических данных у 51 больного раком толстой кишки показало семейное накопление различных злокачественных новообразований у 20 из них, причем в 3 случаях идентифицирован синдром раковых семей (синдром Линча II). В семейном анамнезе больных, у которых были выявлены мутации в гене K-ras (7/19), также имелись указания на накопления опухолей толстой кишки, которые встречались отдельно и в сочетании с другими злокачественными новообразованиями, однако ни в одной из указанных родословных признаков, указывающих на наследственный вариант рака толстой кишки, не обнаружено. Эти данные позволяют предположить, что мутации гена K-ras не играют важной роли в возникновении семейного рака толстой кишки.

Изучение частоты точечных мутаций в гене K-ras у больных со спорадическими аденокарциномами толстой кишки с различной степенью дифференцировки на разных стадиях заболевания показало, что она составляет 37,3%, что совпадает с данными, полученными некоторыми авторами в Швейцарии (39,2%), Нидерландах (39,0%), Италии (40,0%) [16, 19, 20], но в Германии и Ирландии частота данных мутаций значительно выше (73,3% и 76,0% соответственно) [4,9]. Доминирующей мутацией в нашей выборке оказалась замена GT→CT в к.12, которая также преобладает у японских больных с аденокарциномами толстой кишки (44,7%) [8]. Суммарная частота мутаций в к.13 гена К-ras у больных раком толстой кишки в нашей выборке составляет 5,9% (табл. 2). Это примерно в 2 раза меньше частоты аналогичных мутаций у пациентов из Швейцарии (9,8%) и Кореи (11,0%) [5, 15]. В табл. 5 представлены данные по частоте мутаций у больных раком толстой кишки, которые для удобства были распределены в соответствии с общепринятой классификацией (табл. 5 и 6).

Как следует из табл. 5, частота и спектр K-ras мутаций отличается в зависимости от гистологической структуры опухолей толстой кишки, среди которых обнаружены 5 типов мутаций в к.12 и к.13 гена К-ras. Максимальное число замен (13 из 19 мутаций) обнаружено в образцах с умереннодифференцированными аденокарциномами, вероятно из-за малочисленности выборки. Наиболее частая из них – замена GGT на GCT в к.12 - выявлена в 7 опухолевых образцах. Однако максимальная частота К-ras-мутаций оказалась характерной для группы высокодифференцированных аденокарцином (71,4%). Поскольку неоплазия возникает из единственного клона клеток, обнаруженная частота К-ras- мутаций в высокодифференцированных аденокарциномах и отсутствие нарастания частоты и типа мутаций гена К-ras при низкодифференцированных аденокарциномах, т.е. при гистологическом утяжелении опухолевых изменений, подтверждают предположение о том, что мутации гена К-ras- возникают рано и что, по видимому, этот онкоген не включается в прогрессию опухоли. Эти данные подтверждаются исследованиями в Нидерландах, которые не получили никаких значимых различий по отношению типам мутаций гена К-ras и стадиям по Дюку рака толстой кишки [3].

Таблица 5.
Частота мутаций в гене K-ras у больных раком толстой кишки в зависимости от гистологической структуры опухолей.

Гистология опухолей Частота мутаций (%) Тип мутаций
Высокодиф-
ференцированная аденокарцинома
71,4 (5/7) GGT→GCT (3/7)
GGT→GAT (2/7)
Умереннодиф-
ференцированная аденокарцинома
33,3 (13/36) GGT→GCT (7/36)
GGT→AGT (1/36)
GGT→GAT (2/36)
GGC→GAC (2/36)
GGC→CGC (1/36)
Низкодиф-
ференцированная аденокарцинома
25,0 (1/4) GGT→GCT (1/4)
Аденокарцинома различной степени дифференциации 0 (0/3) -

Примечание: отличия в частоте встречаемости высокодифференцированных и умереннодифференцированных аденокарцином по сравнению с аденокарциномами разной степени дифференцировки толстой кишки статистически значимы (p<0,001).

В табл. 6 приведено распределение точечных мутаций протоонкогена К-ras в аденокарциномах в зависимости от их локализации в толстой кишке. В исследованной нами группе больных наибольшее количество мутаций было выявлено в сигмовидной кишке (8 из 19 мутаций) (p<0,01). В этом отделе толстой кишки мы обнаружили 5 типов мутаций. В целом максимальное число замен в гене K-ras оказалось в левой половине толстой кишки (16 из19 мутаций) (p<0,001), включая ректосигмоидный отдел и прямую кишку, возможно из-за того, что эта группа была самой многочисленной (43/50). Тем не менее, наибольшая частота исследованных нами мутаций в гене K-ras характерна для правой части толстой кишки: 42,9% (3/7), тогда как в левой части она составляет 37,2% (16/43). Эти данные относительно более высокой частоты K-ras мутаций в правой части толстой кишки согласуются с результатами других авторов, обследовавших аналогичных пациентов из Венгрии (n=88) [14] и Нидерландов (n=55) [5]. Существует мнение, что точечные мутации в гене K-ras в аденокарциномах восходящего отдела толстой кишки могут быть причиной более неблагоприятного прогноза заболевания, тогда как те же самые мутации в правой части толстой кишки не влияют на выживание пациентов [2, 14].

Таблица 6.
Частота мутаций в гене K-ras у больных раком толстой кишки в зависимости от их локализации.

Локализация Частота мутаций (%)
Слепая кишка 0,0 (0/3)
Поперечно-ободочная кишка Восходящий отдел 75,0 (3/4)
  Нисходящий отдел 37,5 (3/8)
Сигмовидная кишка 36,4 (8/22)
Ректосигмоидный отдел 60,0 (3/5)
Прямая кишка 25,0 (2/8)

Примечание: отличия в частоте встречаемости мутаций: 1) между слепой кишкой и восходящим и нисходящим отделами поперечно-ободочной кишки статистически значимы (p<0,005 и p<0,05 соответственно; 2) между слепой кишкой и ректосигмоидным отделом толстой кишки статистически значимы (p<0,05); 3) между слепой и сигмовидной кишкой статистически значимы (p<0,005).

Согласно данным литературы, мутации в гене K-ras присутствуют почти во всех аденокарциномах поджелудочной железы и в 50 % опухолей толстой кишки человека. Наличие мутаций у пациентов с аденокарциномами поджелудочной железы и отсутствие таковых в опухолях эндокринного происхождения той же локализации, а также при хронических панкреатитах и в нормальных тканях поджелудочной железы позволяет рассматривать возможность использования мутаций онкогена K-ras в качестве молекулярных маркеров для формирования групп высокого риска, для прогноза и контроля лечения [6, 12]. Решение всех этих задач существенно облегчается возможностью поиска K-ras мутаций в материале, собранном при эндоскопии: в секрете поджелудочной железы, в слизистой протоков поджелудочной железы после браш-теста или при холангиопанкреатографии, в дуоденальном соке и даже в стуле пациента. Обнаружение мутаций в гене K-ras в перечисленном выше биологическом материале может указывать на рак поджелудочной железы, тогда как их отсутствие увеличивает вероятность доброкачественной опухоли [18].

Что касается опухолей толстой кишки человека, то результаты многочисленных исследований, оценивающих прогностическое значение K-ras мутаций, весьма противоречивы. В некоторых работах не удалось показать корреляцию между K-ras мутациями и малигнизацией в толстой кишке [11]. Однако, в других исследованиях, включая работу с самой многочисленной на сегодняшний день выборкой (1413 пациентов), авторы пришли к выводу, что присутствие K-ras мутаций в опухолях толстой кишки все же является определенным фактором прогноза [17]. Несовпадение этих результатов, по нашему мнению, отчасти можно объяснить, во-первых, небольшими выборками пациентов в большинстве работ и, во-вторых, использованием различных методов детекции K-ras мутаций, обладающих разной разрешающей способностью (гибридизация, рестрикционный анализ, SSCP–анализ, DGGE–анализ). Тем не менее, эти исследования являются перспективными, т.к. позволяют проводить довольно быстрый скрининг диспластических поражений всех участков толстой кишки с целью формирования групп риска. Обнаружение K-ras мутаций в опухолях толстой кишки позволяет использовать их в качестве молекулярных маркеров для прогноза, а также контроля послеоперационного лечения. Как и в случае с поджелудочной железой, эта задача облегчается возможностью выявления K-ras мутаций в биологическом материале: копрологических и биопсийных препаратах, в кишечном секрете, в образцах плазмы крови. Для улучшения надежности молекулярного прогноза опухолей толстой кишки возможно использование нескольких генетических маркеров, определяющих одни и те же или различные этапы малигнизации.

Список литературы:

1. Амосенко Ф.А., Трубникова И.С., Захарьев В.М. и др. Полиморфизм TUB9 в гене ТРБМ больных муковисцидозом, носителей и здоровых доноров Московского региона. SSCP-анализ и рестрикционный анализ. // Генетика, 1997,т.33, №2, с.257-261.

2. Bleeker W.A., Hayes V.M., Karrenbeld A. et al. Impact of K-ras and TP53 mutations on survival in patients with left- and right-sided Dukes’C colon cancer. // Am. J. Gastroenterol., 2000, V.95 (10), P. 2953–2957.

3. Bouzourene H., Gervaz P., Cerottini J.P. et al. p53 and Ki-ras as prognostic factors for Dukes’ stage B colorectal cancer. // Eur. J. Cancer, 2000;V.36, P.1008–1015.

4. Clarke G.A., Ryan E., Crowe J.P. Tumor-derived mutated K-ras codon 12 expression in regional lymph nodes of stage II colorectal cancer patients is not associated with increased risk of cancer-related death. // Int. J. Colorectal Dis., 2001, V. 16(2), P.08-111.

5. Doolittle B.R., Emanuel J., Tuttle C. Detection of the mutated K-Ras biomarker in colorectal carcinoma. // Exp. Mol. Pathol., 2001, V.70 (3), P.:289-301.

6. Gong X., Chen Y. et al. K-ras mutations in pancreatic juice from patients with pancreatic carcinoma. // Zhonghia Nei Ke Za Zhi, 1999, Oct., 38 (10), P.673-676.

7. Haber D.A., Fearon E.R. The promise of cancer genetics. // Suppl. To The Lancet, 1998, P.1–8

8. Haseva H., Ueda M., Watanabe M. et al. K–ras gene mutations in early colorectal cancer flat elevated vs polyp-forming cancer // Oncogene, 1995,10, 1413–1416.

9. Lauschke H., Caspari R., Friedl W. et al. Detection of APC and k-ras mutations in the serum of patients with colorectal cancer. // Cancer Detect. Prev., 2001, V. 5(1): 55-61

10. Lynch H., Smyrk T., Scott E. et al. Familial pancreatic cancer: a review. // Seminars in Oncology, 1996, V.23, №2, P.251-275.

11. Morrin M., Kelly M., Barrett N., Delaney P. Mutations of Ki-ras and p53 genes in colorectal cancer and their prognostic significance. // Gut, 1994; 35: 1127–1131.

12. Nishikama T., Maemura K., Hirata I. et al. A simple method of detection K-ras point mutations in stool samples for colorectal cancer screening using one-step polymerase chain reaction/restriction fragment length polymorphism analysis. // Clin. Chim. Acta, 2002,V.318 (1-2), P.107-112.

13. Paal E., Thompson L.D., Frommelt R.A. et al. A clinicopathologic and immunohistochemical study of 35 anaplastic carcinomas of the pancreas with a review of the literature. // Ann. Diagn. Pathol., 2001, V.5 (3):129-140.

14. Pajkos G., Kiss I., Sandor J. et al. The prognostic value of the presence of mutations at the codons 12, 13, 61 of K-ras oncogene in colorectal cancer. // Anti cancer Res., 2000, V.20 (3A), P.1695–1701.

15. Park T.J., Han S.U., Cho Y.K. Methylation of O(6)-methylguanine-DNA methyltransferase gene is associated significantly with K-ras mutation, lymph node invasion, tumor staging, and disease free survival in patients with gastric carcinoma. // Cancer, 2001, V. 92(11): 2760-2768.

16. Rengucci C., Maiolo P., Saragoni L. et al. Multiple detection of genetic alterations in tumors and stool. // Clin. Cancer Res., 2001, V.7 (3), P.590-593.

17. Samowitz W.S., Curtin K., Schaffer D. et al. Relationship of K-ras mutations in colon cancers to tumor localization, stage, and survival: population-based study // Cancer Epidemiol. Biomarkers Prev. 2000.V.9, P.1193-119.

18. Tada M., Komatsu Y., Kawabe T. et al. Quantitative analysis of K-ras gene mutation in pancreatic tissue obtained by endoscopic ultrasonography – guided fine needle aspiration: clinical utility for diagnosis of pancreatic tumor. // Am. J. Gastroenterol. 2002. V.97. N9, P.2263-2270.

19. Tortola S., Steinert R., Hantschick M. Discordance between K-ras mutations in bone marrow micrometastases and the primary tumor in colorectal cancer. // J. Clin. Oncol, 2001, V. 119 (11), P.2837-2843.

20. Van Engeland M., Roemen G.M., Brink M. et al. K-ras mutations and RASSF1 a promoter methylation in colorectal cancer. // Oncogene, 2002, May, 23; 21(23): 3792-5.